Review



sgrna plasmid library  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Addgene inc sgrna plasmid library
    Sgrna Plasmid Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 15388 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/psPAX2+(Plasmid+%2312260)/pm41854249-85-2-7
    Average 98 stars, based on 15388 article reviews
    sgrna plasmid library - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Knock-Out:

    Article Title: CRISPR/Cas technologies in pancreatic cancer research and therapeutics: recent advances and future outlook
    Article Snippet: 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 500 nM Irinotecan, and 7.5 μm 5-FU (for PANC-1) and 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 250 nM irinotecan, and 5 μm 5-FU (for BxPC3) for 4 days , Panc-1 and BxPC3 , Knockout, Activation , GeCKO library (addgeneNo.1000000049), SAM pooled sgRNA library (addgene No. 1000000057) , HDAC1, VPS25, ABCG2 , CRISPRa, CRISPR knockout , -Increased expression of several genes involved in the EMT (Following increased HDAC1) , [ ] . .. 10 μg/mL puromycin for 3 days , TB32047 , Knockout , The pooled sgRNA library (Mouse Brie kinome pooled library) (addgene No. 75316) with additional sgRNAs for genes involved in pancreatic cancer , CDK7 , CRISPR knockout, Pharmacological inhibition , -Induced cell cycle arrest Increased apoptosis and DNA damage -Increased gemcitabine and paclitaxel sensitivity -Reduced tumor growth in vivo , [ ] . .. Puromycin for 7 days , Pa-Tu-8988T and YAPC , Knockout , GeCKOv2 library , PKMYT1 , CRISPR knockout, Pharmacological inhibition , -Increased apoptosis -Induced cell cycle arrest , [ ] .

    Article Title: CDK4/6 inhibition overcomes venetoclax resistance mechanisms with enhanced combination activity in acute myeloid leukemia.
    Article Snippet: .. Clonal OCI-AML2 Cas9 C6 cells were used for genome wide knockout with sgRNA library (Addgene #67989) as described above. ..

    Article Title: CDK4/6 inhibition overcomes venetoclax resistance mechanisms with enhanced combination activity in acute myeloid leukemia
    Article Snippet: .. Clonal OCI-AML2 Cas9 C6 cells were used for genome wide knockout with sgRNA library (Addgene #67989) as described above. ..

    Article Title: High CDC20 levels increase sensitivity of cancer cells to MPS1 inhibitors.
    Article Snippet: Spindle assembly checkpoint (SAC) inhibitors are a recently developed class of drugs, which perturb chromosome segregation during cell division, induce chromosomal instability (CIN), and eventually lead to cell death.. The molecular features that determine cellular sensitivity to these drugs are not fully understood.. We recently reported that aneuploid cancer cells are preferentially sensitive to SAC inhibition.

    CRISPR:

    Article Title: CRISPR/Cas technologies in pancreatic cancer research and therapeutics: recent advances and future outlook
    Article Snippet: 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 500 nM Irinotecan, and 7.5 μm 5-FU (for PANC-1) and 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 250 nM irinotecan, and 5 μm 5-FU (for BxPC3) for 4 days , Panc-1 and BxPC3 , Knockout, Activation , GeCKO library (addgeneNo.1000000049), SAM pooled sgRNA library (addgene No. 1000000057) , HDAC1, VPS25, ABCG2 , CRISPRa, CRISPR knockout , -Increased expression of several genes involved in the EMT (Following increased HDAC1) , [ ] . .. 10 μg/mL puromycin for 3 days , TB32047 , Knockout , The pooled sgRNA library (Mouse Brie kinome pooled library) (addgene No. 75316) with additional sgRNAs for genes involved in pancreatic cancer , CDK7 , CRISPR knockout, Pharmacological inhibition , -Induced cell cycle arrest Increased apoptosis and DNA damage -Increased gemcitabine and paclitaxel sensitivity -Reduced tumor growth in vivo , [ ] . .. Puromycin for 7 days , Pa-Tu-8988T and YAPC , Knockout , GeCKOv2 library , PKMYT1 , CRISPR knockout, Pharmacological inhibition , -Increased apoptosis -Induced cell cycle arrest , [ ] .

    Article Title: High CDC20 levels increase sensitivity of cancer cells to MPS1 inhibitors.
    Article Snippet: Spindle assembly checkpoint (SAC) inhibitors are a recently developed class of drugs, which perturb chromosome segregation during cell division, induce chromosomal instability (CIN), and eventually lead to cell death.. The molecular features that determine cellular sensitivity to these drugs are not fully understood.. We recently reported that aneuploid cancer cells are preferentially sensitive to SAC inhibition.

    Inhibition:

    Article Title: CRISPR/Cas technologies in pancreatic cancer research and therapeutics: recent advances and future outlook
    Article Snippet: 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 500 nM Irinotecan, and 7.5 μm 5-FU (for PANC-1) and 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 250 nM irinotecan, and 5 μm 5-FU (for BxPC3) for 4 days , Panc-1 and BxPC3 , Knockout, Activation , GeCKO library (addgeneNo.1000000049), SAM pooled sgRNA library (addgene No. 1000000057) , HDAC1, VPS25, ABCG2 , CRISPRa, CRISPR knockout , -Increased expression of several genes involved in the EMT (Following increased HDAC1) , [ ] . .. 10 μg/mL puromycin for 3 days , TB32047 , Knockout , The pooled sgRNA library (Mouse Brie kinome pooled library) (addgene No. 75316) with additional sgRNAs for genes involved in pancreatic cancer , CDK7 , CRISPR knockout, Pharmacological inhibition , -Induced cell cycle arrest Increased apoptosis and DNA damage -Increased gemcitabine and paclitaxel sensitivity -Reduced tumor growth in vivo , [ ] . .. Puromycin for 7 days , Pa-Tu-8988T and YAPC , Knockout , GeCKOv2 library , PKMYT1 , CRISPR knockout, Pharmacological inhibition , -Increased apoptosis -Induced cell cycle arrest , [ ] .

    In Vivo:

    Article Title: CRISPR/Cas technologies in pancreatic cancer research and therapeutics: recent advances and future outlook
    Article Snippet: 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 500 nM Irinotecan, and 7.5 μm 5-FU (for PANC-1) and 25 nM Gemcitabine, 2.5 μm Oxaliplatin, 250 nM irinotecan, and 5 μm 5-FU (for BxPC3) for 4 days , Panc-1 and BxPC3 , Knockout, Activation , GeCKO library (addgeneNo.1000000049), SAM pooled sgRNA library (addgene No. 1000000057) , HDAC1, VPS25, ABCG2 , CRISPRa, CRISPR knockout , -Increased expression of several genes involved in the EMT (Following increased HDAC1) , [ ] . .. 10 μg/mL puromycin for 3 days , TB32047 , Knockout , The pooled sgRNA library (Mouse Brie kinome pooled library) (addgene No. 75316) with additional sgRNAs for genes involved in pancreatic cancer , CDK7 , CRISPR knockout, Pharmacological inhibition , -Induced cell cycle arrest Increased apoptosis and DNA damage -Increased gemcitabine and paclitaxel sensitivity -Reduced tumor growth in vivo , [ ] . .. Puromycin for 7 days , Pa-Tu-8988T and YAPC , Knockout , GeCKOv2 library , PKMYT1 , CRISPR knockout, Pharmacological inhibition , -Increased apoptosis -Induced cell cycle arrest , [ ] .

    Genome Wide:

    Article Title: CDK4/6 inhibition overcomes venetoclax resistance mechanisms with enhanced combination activity in acute myeloid leukemia.
    Article Snippet: .. Clonal OCI-AML2 Cas9 C6 cells were used for genome wide knockout with sgRNA library (Addgene #67989) as described above. ..

    Article Title: CDK4/6 inhibition overcomes venetoclax resistance mechanisms with enhanced combination activity in acute myeloid leukemia
    Article Snippet: .. Clonal OCI-AML2 Cas9 C6 cells were used for genome wide knockout with sgRNA library (Addgene #67989) as described above. ..

    Cloning:

    Article Title: Single-cell activation screen identifies hepatic maturation regulators with zonal resolution.
    Article Snippet: 114 Respective elements were cloned into the backbone plasmid pBR-blue-R26KS (kind gift from Dr. Niwa), containing homology arms of Rosa26 locus, by NEBuilder HiFi DNA Assembly, resulting in the generation of pBRblue-R26KS-UCOE-CAG-dCas9 and pBRblue-R26KS-UCOE-CAGMS2 plasmids. .. For cloning the individual sgRNA or sgRNA library into the CROP-sgRNA-MS2 backbone (Addgene 153457), oligos containing the sgRNA target sequence flanked by the 5’ U6 promoter sequence (TATCTTGTGGAAAGGACGAAACACCG) and a 3’ sgRNA scaffold sequence (GTTTAAGAGCTAGGCCAACATGAGGATCACCCATG) were synthesized by SIGMA or Twist Bioscience, respectively (Table S2). ..

    Sequencing:

    Article Title: Single-cell activation screen identifies hepatic maturation regulators with zonal resolution.
    Article Snippet: 114 Respective elements were cloned into the backbone plasmid pBR-blue-R26KS (kind gift from Dr. Niwa), containing homology arms of Rosa26 locus, by NEBuilder HiFi DNA Assembly, resulting in the generation of pBRblue-R26KS-UCOE-CAG-dCas9 and pBRblue-R26KS-UCOE-CAGMS2 plasmids. .. For cloning the individual sgRNA or sgRNA library into the CROP-sgRNA-MS2 backbone (Addgene 153457), oligos containing the sgRNA target sequence flanked by the 5’ U6 promoter sequence (TATCTTGTGGAAAGGACGAAACACCG) and a 3’ sgRNA scaffold sequence (GTTTAAGAGCTAGGCCAACATGAGGATCACCCATG) were synthesized by SIGMA or Twist Bioscience, respectively (Table S2). ..

    Article Title: Genome-wide CRISPR screen reveals host factors for gama- and delta-coronavirus infection in Huh7 cells.
    Article Snippet: Genome-wide CRISPR screening has emerged as a powerful tool for identifying novel host factors involved in viral infections.. In recent years, host factors for several Alphaand Beta-coronaviruses have been systematically screened and characterized.. However, knowledge regarding Gammaand Delta-coronavirus infections remains limited.

    Synthesized:

    Article Title: Single-cell activation screen identifies hepatic maturation regulators with zonal resolution.
    Article Snippet: 114 Respective elements were cloned into the backbone plasmid pBR-blue-R26KS (kind gift from Dr. Niwa), containing homology arms of Rosa26 locus, by NEBuilder HiFi DNA Assembly, resulting in the generation of pBRblue-R26KS-UCOE-CAG-dCas9 and pBRblue-R26KS-UCOE-CAGMS2 plasmids. .. For cloning the individual sgRNA or sgRNA library into the CROP-sgRNA-MS2 backbone (Addgene 153457), oligos containing the sgRNA target sequence flanked by the 5’ U6 promoter sequence (TATCTTGTGGAAAGGACGAAACACCG) and a 3’ sgRNA scaffold sequence (GTTTAAGAGCTAGGCCAACATGAGGATCACCCATG) were synthesized by SIGMA or Twist Bioscience, respectively (Table S2). ..

    Transduction:

    Article Title: Novel reporter of the PINK1-Parkin mitophagy pathway identifies its damage sensor in the import gate
    Article Snippet: .. Cells were transduced with the dual- sgRNA library from the Weissman Lab (Dual sgRNA CRISPRi Library 1-2 was a gift from Jonathan Weissman Addgene #187246) at an MOI of 0.3 based off the virus titer . ..

    Article Title: High CDC20 levels increase sensitivity of cancer cells to MPS1 inhibitors.
    Article Snippet: Spindle assembly checkpoint (SAC) inhibitors are a recently developed class of drugs, which perturb chromosome segregation during cell division, induce chromosomal instability (CIN), and eventually lead to cell death.. The molecular features that determine cellular sensitivity to these drugs are not fully understood.. We recently reported that aneuploid cancer cells are preferentially sensitive to SAC inhibition.

    Virus:

    Article Title: Novel reporter of the PINK1-Parkin mitophagy pathway identifies its damage sensor in the import gate
    Article Snippet: .. Cells were transduced with the dual- sgRNA library from the Weissman Lab (Dual sgRNA CRISPRi Library 1-2 was a gift from Jonathan Weissman Addgene #187246) at an MOI of 0.3 based off the virus titer . ..

    Transfection:

    Article Title: High CDC20 levels increase sensitivity of cancer cells to MPS1 inhibitors.
    Article Snippet: Spindle assembly checkpoint (SAC) inhibitors are a recently developed class of drugs, which perturb chromosome segregation during cell division, induce chromosomal instability (CIN), and eventually lead to cell death.. The molecular features that determine cellular sensitivity to these drugs are not fully understood.. We recently reported that aneuploid cancer cells are preferentially sensitive to SAC inhibition.

    Plasmid Preparation:

    Article Title: High CDC20 levels increase sensitivity of cancer cells to MPS1 inhibitors.
    Article Snippet: Spindle assembly checkpoint (SAC) inhibitors are a recently developed class of drugs, which perturb chromosome segregation during cell division, induce chromosomal instability (CIN), and eventually lead to cell death.. The molecular features that determine cellular sensitivity to these drugs are not fully understood.. We recently reported that aneuploid cancer cells are preferentially sensitive to SAC inhibition.

    Introduce:

    Article Title: High CDC20 levels increase sensitivity of cancer cells to MPS1 inhibitors.
    Article Snippet: Spindle assembly checkpoint (SAC) inhibitors are a recently developed class of drugs, which perturb chromosome segregation during cell division, induce chromosomal instability (CIN), and eventually lead to cell death.. The molecular features that determine cellular sensitivity to these drugs are not fully understood.. We recently reported that aneuploid cancer cells are preferentially sensitive to SAC inhibition.

    Amplification:

    Article Title: Genome-wide CRISPR screen reveals host factors for gama- and delta-coronavirus infection in Huh7 cells.
    Article Snippet: Genome-wide CRISPR screening has emerged as a powerful tool for identifying novel host factors involved in viral infections.. In recent years, host factors for several Alphaand Beta-coronaviruses have been systematically screened and characterized.. However, knowledge regarding Gammaand Delta-coronavirus infections remains limited.

    Activity Assay:

    Article Title: High CDC20 levels increase sensitivity of cancer cells to MPS1 inhibitors.
    Article Snippet: Spindle assembly checkpoint (SAC) inhibitors are a recently developed class of drugs, which perturb chromosome segregation during cell division, induce chromosomal instability (CIN), and eventually lead to cell death.. The molecular features that determine cellular sensitivity to these drugs are not fully understood.. We recently reported that aneuploid cancer cells are preferentially sensitive to SAC inhibition.



    Similar Products

    99
    New England Biolabs pooled sgrna oligonucleotide library
    Pooled Sgrna Oligonucleotide Library, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/NEBNext+High-Fidelity+PCR+Master+Mix/pm42003616-164-2-9
    Average 99 stars, based on 1 article reviews
    pooled sgrna oligonucleotide library - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Synthego Inc sgrna human druggable genome library
    Sgrna Human Druggable Genome Library, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/druggable+genome+human+library+sgrna/pm42154535-284-2-1
    Average 86 stars, based on 1 article reviews
    sgrna human druggable genome library - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc sgrna library targets
    Sgrna Library Targets, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/druggable+genome+human+library+sgrna/pm42154535-47-5-1
    Average 86 stars, based on 1 article reviews
    sgrna library targets - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Cellecta Inc whole genome crispr cas9 sgrna library
    Whole Genome Crispr Cas9 Sgrna Library, supplied by Cellecta Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/2a+blast+cas9+cas9+cell+cellecta+cmv+crispr+generation+line+prccb/pm42096614-103-1-5
    Average 86 stars, based on 1 article reviews
    whole genome crispr cas9 sgrna library - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    98
    Addgene inc sgrna plasmid library
    Sgrna Plasmid Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/psPAX2+(Plasmid+%2312260)/pm41854249-85-2-7
    Average 98 stars, based on 1 article reviews
    sgrna plasmid library - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    86
    Twist Bioscience sgrna oligonucleotide library
    (A) Volcano plot showing the changes of n=222 ArN TF genes selected for Perturb-seq between N and N+A conditions, average of 4 time points. (B) Table showing statistics of <t>sgRNA</t> library design and data quality metrics for CRISPRi and CRISPRa pRE screens. (C) Scatterplot of showing the numbers of CRISPRi vs CRISPRa pRE targets per ArN TF gene, with genes that are up-regulated by astrocytes at the mRNA level colored in red, and genes down-regulated by astrocytes colored by blue. (D) Barplot showing that the dCas9-p300 cell line activates GRIN2A and MYOD genes by sgRNAs targeted at promoters and a distal regulatory element in differentiated neurons. (E) Histogram showing the distributions of base-pair distance between functional RE and target genes identified in the CRISPRi and CRISPRa pRE screens, respectively. (F) Barplots showing the distribution of # of target genes assigned to a functional RE, and # of functional REs assigned to a target gene, respectively. (G) Barplot showing the effects of CRISPRi on two different functional REs of the TF gene SIX3. The statistical test was done by one-way ANOVA followed by Tukey’s multiple comparisons test. **: adjusted p<0.01; ***: adjusted p<0.001. (H) Schematics showing a high-level overview of the single-cell analysis pipeline of the Perturb-seq screens, highlighting the methods used.
    Sgrna Oligonucleotide Library, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/library+sgrna/bio_rxiv__64898__2026__03__07__710282-324-1-7
    Average 86 stars, based on 1 article reviews
    sgrna oligonucleotide library - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral sgrna library backbone plasmid
    (A) Summary of gene deletion vs. gene overexpression approaches. (B) Rationale for the present study. (C) Experimental outline of the present study. (D) HEK293 and Jurkat cells were inoculated with different volumes of Ebola or rabies pseudovirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This revealed that Jurkat cells are largely refractory to Ebola or rabies pseudovirus entry, relative to HEK293 cells. (E) Construction of a clonal Jurkat cell line, known as “Jurkat C6”, stably expressing a degron-tagged CRISPRa construct ( left ). Jurkat C6 cells were transduced with <t>sgRNA</t> targeting the endogenous human CD19 gene, in the presence or absence of TMP (1 μM) for 3 days, followed by flow cytometry to detect hCD19 expression ( right ). (F) At each of the indicated points of the genome-wide CRISPRa screen, the cell population was challenged with Ebola or rabies pseudovirus, and cell infectivity was evaluated by flow cytometry. Upon successive rounds of the screen, the cell population became progressively more susceptible to infection to either Ebola or rabies pseudovirus, respectively. (G) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for Ebola pseudovirus entry. (H) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for rabies pseudovirus entry.
    Lentiviral Sgrna Library Backbone Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/pCRISPRia-v2+(Plasmid+%2384832)/bio_rxiv__64898__2026__03__06__710083-157-10-15
    Average 96 stars, based on 1 article reviews
    lentiviral sgrna library backbone plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Addgene inc human genome wide crispra sgrna library
    (A) Summary of gene deletion vs. gene overexpression approaches. (B) Rationale for the present study. (C) Experimental outline of the present study. (D) HEK293 and Jurkat cells were inoculated with different volumes of Ebola or rabies pseudovirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This revealed that Jurkat cells are largely refractory to Ebola or rabies pseudovirus entry, relative to HEK293 cells. (E) Construction of a clonal Jurkat cell line, known as “Jurkat C6”, stably expressing a degron-tagged <t>CRISPRa</t> construct ( left ). Jurkat C6 cells were transduced with <t>sgRNA</t> targeting the endogenous human CD19 gene, in the presence or absence of TMP (1 μM) for 3 days, followed by flow cytometry to detect hCD19 expression ( right ). (F) At each of the indicated points of <t>the</t> <t>genome-wide</t> CRISPRa screen, the cell population was challenged with Ebola or rabies pseudovirus, and cell infectivity was evaluated by flow cytometry. Upon successive rounds of the screen, the cell population became progressively more susceptible to infection to either Ebola or rabies pseudovirus, respectively. (G) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for Ebola pseudovirus entry. (H) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for rabies pseudovirus entry.
    Human Genome Wide Crispra Sgrna Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/Human+Genome-wide+CRISPRa-v2+Libraries+(Pooled+Libraries+%2383978%2C+%231000000091)/bio_rxiv__64898__2026__03__06__710083-138-1-7
    Average 94 stars, based on 1 article reviews
    human genome wide crispra sgrna library - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Addgene inc library expression vector pu6 sgrna ef1alpha puro t2a gfp
    (A) Summary of gene deletion vs. gene overexpression approaches. (B) Rationale for the present study. (C) Experimental outline of the present study. (D) HEK293 and Jurkat cells were inoculated with different volumes of Ebola or rabies pseudovirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This revealed that Jurkat cells are largely refractory to Ebola or rabies pseudovirus entry, relative to HEK293 cells. (E) Construction of a clonal Jurkat cell line, known as “Jurkat C6”, stably expressing a degron-tagged <t>CRISPRa</t> construct ( left ). Jurkat C6 cells were transduced with <t>sgRNA</t> targeting the endogenous human CD19 gene, in the presence or absence of TMP (1 μM) for 3 days, followed by flow cytometry to detect hCD19 expression ( right ). (F) At each of the indicated points of <t>the</t> <t>genome-wide</t> CRISPRa screen, the cell population was challenged with Ebola or rabies pseudovirus, and cell infectivity was evaluated by flow cytometry. Upon successive rounds of the screen, the cell population became progressively more susceptible to infection to either Ebola or rabies pseudovirus, respectively. (G) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for Ebola pseudovirus entry. (H) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for rabies pseudovirus entry.
    Library Expression Vector Pu6 Sgrna Ef1alpha Puro T2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/pU6-sgRNA+Ef1alpha+Puro-T2A-GFP+(Plasmid+%23111596)/pmc12948414-158-18-28
    Average 93 stars, based on 1 article reviews
    library expression vector pu6 sgrna ef1alpha puro t2a gfp - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Addgene inc genome wide ko eko sgrna library
    <t>Genome-wide</t> <t>CRISPR-Cas9</t> screen identifies genetic determinants of GTE-induced cytotoxicity. (A) Schematic overview of the experimental workflow for the genome-wide CRISPR knockout screen in NALM-6 cells treated with green tea extract (GTE), aimed at identifying genes modulating compound sensitivity. (B) Distribution of CRANKS scores for 19,034 genes following GTE treatment. Negative scores (red arrows, CRANKS ≤ −2) indicate sensitizer genes whose knockout enhances compound sensitivity, while positive scores (green arrows, CRANKS ≥2) represent rescuers whose knockout confers resistance. The 2D scatter plot is aligned with a one-dimensional frequency distribution, illustrating the thresholds used to define top hits. (C) Volcano plot showing CRANKS scores plotted against –log 10 p -values. Genes above the horizontal dashed line marks the p -threshold ( p < 0.05), while those beyond the vertical dashed lines exceed CRANKS thresholds of ±2, identifying 30 filtered genes ( p ≤ 0.01) labeled by gene symbol. Red points represent sensitizers; green points represent rescuers. Listed starred gene (∗) indicate top hits. (D) KEGG pathway enrichment analysis of highest CRANKS-filtered candidates (|CRANKS| ≥ 2; p ≤ 0.01; set including all top hits). Bubble color reflects false discovery rate (FDR), ranging from light green (FDR = 9 × 10 −7 ) to dark blue (FDR = 4 × 10 −3 ), and bubble size corresponds to the number of genes in each pathway. Pathways are ranked by significance on the y-axis. Analysis was performed using the STRING database with whole-genome background, requiring a minimum of two genes per pathway and FDR ≤0.05.
    Genome Wide Ko Eko Sgrna Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+library/pUT1854-HQ858793+(Plasmid+%2327875)/pmc12860261-49-27-21
    Average 94 stars, based on 1 article reviews
    genome wide ko eko sgrna library - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    (A) Volcano plot showing the changes of n=222 ArN TF genes selected for Perturb-seq between N and N+A conditions, average of 4 time points. (B) Table showing statistics of sgRNA library design and data quality metrics for CRISPRi and CRISPRa pRE screens. (C) Scatterplot of showing the numbers of CRISPRi vs CRISPRa pRE targets per ArN TF gene, with genes that are up-regulated by astrocytes at the mRNA level colored in red, and genes down-regulated by astrocytes colored by blue. (D) Barplot showing that the dCas9-p300 cell line activates GRIN2A and MYOD genes by sgRNAs targeted at promoters and a distal regulatory element in differentiated neurons. (E) Histogram showing the distributions of base-pair distance between functional RE and target genes identified in the CRISPRi and CRISPRa pRE screens, respectively. (F) Barplots showing the distribution of # of target genes assigned to a functional RE, and # of functional REs assigned to a target gene, respectively. (G) Barplot showing the effects of CRISPRi on two different functional REs of the TF gene SIX3. The statistical test was done by one-way ANOVA followed by Tukey’s multiple comparisons test. **: adjusted p<0.01; ***: adjusted p<0.001. (H) Schematics showing a high-level overview of the single-cell analysis pipeline of the Perturb-seq screens, highlighting the methods used.

    Journal: bioRxiv

    Article Title: Reprogramming of neuronal genome function and phenotype by astrocytes

    doi: 10.64898/2026.03.07.710282

    Figure Lengend Snippet: (A) Volcano plot showing the changes of n=222 ArN TF genes selected for Perturb-seq between N and N+A conditions, average of 4 time points. (B) Table showing statistics of sgRNA library design and data quality metrics for CRISPRi and CRISPRa pRE screens. (C) Scatterplot of showing the numbers of CRISPRi vs CRISPRa pRE targets per ArN TF gene, with genes that are up-regulated by astrocytes at the mRNA level colored in red, and genes down-regulated by astrocytes colored by blue. (D) Barplot showing that the dCas9-p300 cell line activates GRIN2A and MYOD genes by sgRNAs targeted at promoters and a distal regulatory element in differentiated neurons. (E) Histogram showing the distributions of base-pair distance between functional RE and target genes identified in the CRISPRi and CRISPRa pRE screens, respectively. (F) Barplots showing the distribution of # of target genes assigned to a functional RE, and # of functional REs assigned to a target gene, respectively. (G) Barplot showing the effects of CRISPRi on two different functional REs of the TF gene SIX3. The statistical test was done by one-way ANOVA followed by Tukey’s multiple comparisons test. **: adjusted p<0.01; ***: adjusted p<0.001. (H) Schematics showing a high-level overview of the single-cell analysis pipeline of the Perturb-seq screens, highlighting the methods used.

    Article Snippet: The sgRNA oligonucleotide library was synthesized by Twist Bioscience using the following sequence format: ATATATCTTGTGGAAAGGACGAAACACCG-[19/20-bp protospacer sequence]-GTTTAAGAGCTATGCTGGAAACAGCATAG.

    Techniques: Functional Assay, Single-cell Analysis

    (A) Stacked bar plots showing the numbers of targeted annotated primary TSSs, alternative TSSs, and unannotated TSSs based on the RNA-seq data generated in this study, in the CRISPRi/a promoter Perturb-seq experiments, respectively. (B) Table showing statistics of sgRNA library design and data quality metrics for CRISPRi and CRISPRa promoter screens. (C) Violin plot showing the number of cells per target region in the CRISPRa promoter Perturb-seq experiment, highlighting the MYC promoter as an outlier. (D) Violin plot showing the log2FC of the direct target genes in the CRISPRi and CRISPRa promoter Perturb-seq experiments, respectively, separated by positive controls (regardless of significance), TF genes with significant alteration in expression level (Sig. perturb.; p < 0.05), and TF genes with non-significant alteration (N.S. perturb.; p >= 0.05). (E) Jitter plot showing the basal expression levels of CRISPRi promoter target genes that were successfully (‘success’) or unsuccessfully (‘fail’) repressed (F) Bar plot showing the numbers of total global perturbation-gene links discovered by the 4 Perturb-seq experiments. Only those from the positive controls, statistically significant promoters (for the promoter experiments), and fREs (for the pRE experiments) are shown. (G) Jitter plot showing the numbers of global perturbation-gene links per perturbation. Only those from the positive controls, statistically significant promoters (for the promoter experiments), and fREs (for the pRE experiments) are shown. Top perturbations are labeled by its local or direct target gene, for fRE and promoter, respectively. Red bolded are positive controls.

    Journal: bioRxiv

    Article Title: Reprogramming of neuronal genome function and phenotype by astrocytes

    doi: 10.64898/2026.03.07.710282

    Figure Lengend Snippet: (A) Stacked bar plots showing the numbers of targeted annotated primary TSSs, alternative TSSs, and unannotated TSSs based on the RNA-seq data generated in this study, in the CRISPRi/a promoter Perturb-seq experiments, respectively. (B) Table showing statistics of sgRNA library design and data quality metrics for CRISPRi and CRISPRa promoter screens. (C) Violin plot showing the number of cells per target region in the CRISPRa promoter Perturb-seq experiment, highlighting the MYC promoter as an outlier. (D) Violin plot showing the log2FC of the direct target genes in the CRISPRi and CRISPRa promoter Perturb-seq experiments, respectively, separated by positive controls (regardless of significance), TF genes with significant alteration in expression level (Sig. perturb.; p < 0.05), and TF genes with non-significant alteration (N.S. perturb.; p >= 0.05). (E) Jitter plot showing the basal expression levels of CRISPRi promoter target genes that were successfully (‘success’) or unsuccessfully (‘fail’) repressed (F) Bar plot showing the numbers of total global perturbation-gene links discovered by the 4 Perturb-seq experiments. Only those from the positive controls, statistically significant promoters (for the promoter experiments), and fREs (for the pRE experiments) are shown. (G) Jitter plot showing the numbers of global perturbation-gene links per perturbation. Only those from the positive controls, statistically significant promoters (for the promoter experiments), and fREs (for the pRE experiments) are shown. Top perturbations are labeled by its local or direct target gene, for fRE and promoter, respectively. Red bolded are positive controls.

    Article Snippet: The sgRNA oligonucleotide library was synthesized by Twist Bioscience using the following sequence format: ATATATCTTGTGGAAAGGACGAAACACCG-[19/20-bp protospacer sequence]-GTTTAAGAGCTATGCTGGAAACAGCATAG.

    Techniques: RNA Sequencing, Generated, Expressing, Labeling

    (A) Summary of gene deletion vs. gene overexpression approaches. (B) Rationale for the present study. (C) Experimental outline of the present study. (D) HEK293 and Jurkat cells were inoculated with different volumes of Ebola or rabies pseudovirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This revealed that Jurkat cells are largely refractory to Ebola or rabies pseudovirus entry, relative to HEK293 cells. (E) Construction of a clonal Jurkat cell line, known as “Jurkat C6”, stably expressing a degron-tagged CRISPRa construct ( left ). Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence or absence of TMP (1 μM) for 3 days, followed by flow cytometry to detect hCD19 expression ( right ). (F) At each of the indicated points of the genome-wide CRISPRa screen, the cell population was challenged with Ebola or rabies pseudovirus, and cell infectivity was evaluated by flow cytometry. Upon successive rounds of the screen, the cell population became progressively more susceptible to infection to either Ebola or rabies pseudovirus, respectively. (G) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for Ebola pseudovirus entry. (H) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for rabies pseudovirus entry.

    Journal: bioRxiv

    Article Title: Elucidating genes sufficient for viral entry into cells through sequential genome-wide CRISPR activation screens

    doi: 10.64898/2026.03.06.710083

    Figure Lengend Snippet: (A) Summary of gene deletion vs. gene overexpression approaches. (B) Rationale for the present study. (C) Experimental outline of the present study. (D) HEK293 and Jurkat cells were inoculated with different volumes of Ebola or rabies pseudovirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This revealed that Jurkat cells are largely refractory to Ebola or rabies pseudovirus entry, relative to HEK293 cells. (E) Construction of a clonal Jurkat cell line, known as “Jurkat C6”, stably expressing a degron-tagged CRISPRa construct ( left ). Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence or absence of TMP (1 μM) for 3 days, followed by flow cytometry to detect hCD19 expression ( right ). (F) At each of the indicated points of the genome-wide CRISPRa screen, the cell population was challenged with Ebola or rabies pseudovirus, and cell infectivity was evaluated by flow cytometry. Upon successive rounds of the screen, the cell population became progressively more susceptible to infection to either Ebola or rabies pseudovirus, respectively. (G) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for Ebola pseudovirus entry. (H) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for rabies pseudovirus entry.

    Article Snippet: To achieve CRISPRa-mediated overexpression, sgRNA sequences were cloned into the lentiviral sgRNA library backbone plasmid (Addgene, 84832) using the restriction sites BstX1 and BlpI.

    Techniques: Over Expression, Marker, Mutagenesis, Flow Cytometry, Infection, Stable Transfection, Expressing, Construct, Transduction, Genome Wide

    A) Plasmids used to pseudotype non-replicating lentiviruses with either Ebola or rabies envelope proteins. EBOV-GP: glycoprotein of Ebola virus, Makona variant. RABV-GP N2C: glycoprotein of rabies virus, N2C variant. B) HEK293 and Jurkat cells were inoculated with different volumes of VSV envelope protein-pseudotyped lentivirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This served as a positive control to confirm that Jurkat cells and HEK293 cells are both susceptible to VSV pseudovirus entry. C) Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence of different TMP concentrations (0-4 μM) for 2-3 days, followed by flow cytometry to detect human CD19 expression.

    Journal: bioRxiv

    Article Title: Elucidating genes sufficient for viral entry into cells through sequential genome-wide CRISPR activation screens

    doi: 10.64898/2026.03.06.710083

    Figure Lengend Snippet: A) Plasmids used to pseudotype non-replicating lentiviruses with either Ebola or rabies envelope proteins. EBOV-GP: glycoprotein of Ebola virus, Makona variant. RABV-GP N2C: glycoprotein of rabies virus, N2C variant. B) HEK293 and Jurkat cells were inoculated with different volumes of VSV envelope protein-pseudotyped lentivirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This served as a positive control to confirm that Jurkat cells and HEK293 cells are both susceptible to VSV pseudovirus entry. C) Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence of different TMP concentrations (0-4 μM) for 2-3 days, followed by flow cytometry to detect human CD19 expression.

    Article Snippet: To achieve CRISPRa-mediated overexpression, sgRNA sequences were cloned into the lentiviral sgRNA library backbone plasmid (Addgene, 84832) using the restriction sites BstX1 and BlpI.

    Techniques: Virus, Variant Assay, Marker, Mutagenesis, Flow Cytometry, Infection, Positive Control, Transduction, Expressing

    A) NGFR was expressed in Jurkat C6 cells using CRISPRa, or alternatively, Jurkat cells using cDNA expression. NGFR -expressing or control cells were then inoculated with rabies pseudovirus encoding mCD19t. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that NGFR expression significantly increased the susceptibility of Jurkat cells to rabies pseudovirus infection. As positive controls, flow cytometry was used to confirm successful delivery of the sgRNA construct as part of the CRISPRa workflow (as denoted by BFP expression) and that NGFR was expressed (upon cDNA expression). B) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression. L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with rabies pseudovirus encoding hEGFRt (a truncated mutant of human EGFR). Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of Jurkat cells and primary T cells to Ebola pseudovirus infection. Cells expressing the highest levels of L-SIGN and DC-SIGN were preferentially infected by Ebola pseudovirus. C) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression, and then L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with GFP -expressing Ebola virus or zsGreen -expressing Sudan virus under BSL4 containment. On days 0, 1, and 2 post-infection, flow cytometry was performed to determine the percentage of infected cells and qPCR was performed on cell culture supernatants to quantify viral genome replication. This revealed that L-SIGN or DC-SIGN expression enabled authentic Ebola and Sudan virus entry into primary human T cells, but viral genome replication was impaired, perhaps reflective of cell-intrinsic restriction factors.

    Journal: bioRxiv

    Article Title: Elucidating genes sufficient for viral entry into cells through sequential genome-wide CRISPR activation screens

    doi: 10.64898/2026.03.06.710083

    Figure Lengend Snippet: A) NGFR was expressed in Jurkat C6 cells using CRISPRa, or alternatively, Jurkat cells using cDNA expression. NGFR -expressing or control cells were then inoculated with rabies pseudovirus encoding mCD19t. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that NGFR expression significantly increased the susceptibility of Jurkat cells to rabies pseudovirus infection. As positive controls, flow cytometry was used to confirm successful delivery of the sgRNA construct as part of the CRISPRa workflow (as denoted by BFP expression) and that NGFR was expressed (upon cDNA expression). B) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression. L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with rabies pseudovirus encoding hEGFRt (a truncated mutant of human EGFR). Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of Jurkat cells and primary T cells to Ebola pseudovirus infection. Cells expressing the highest levels of L-SIGN and DC-SIGN were preferentially infected by Ebola pseudovirus. C) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression, and then L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with GFP -expressing Ebola virus or zsGreen -expressing Sudan virus under BSL4 containment. On days 0, 1, and 2 post-infection, flow cytometry was performed to determine the percentage of infected cells and qPCR was performed on cell culture supernatants to quantify viral genome replication. This revealed that L-SIGN or DC-SIGN expression enabled authentic Ebola and Sudan virus entry into primary human T cells, but viral genome replication was impaired, perhaps reflective of cell-intrinsic restriction factors.

    Article Snippet: To achieve CRISPRa-mediated overexpression, sgRNA sequences were cloned into the lentiviral sgRNA library backbone plasmid (Addgene, 84832) using the restriction sites BstX1 and BlpI.

    Techniques: Expressing, Control, Flow Cytometry, Infection, Construct, Mutagenesis, Virus, Cell Culture

    (A) Summary of gene deletion vs. gene overexpression approaches. (B) Rationale for the present study. (C) Experimental outline of the present study. (D) HEK293 and Jurkat cells were inoculated with different volumes of Ebola or rabies pseudovirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This revealed that Jurkat cells are largely refractory to Ebola or rabies pseudovirus entry, relative to HEK293 cells. (E) Construction of a clonal Jurkat cell line, known as “Jurkat C6”, stably expressing a degron-tagged CRISPRa construct ( left ). Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence or absence of TMP (1 μM) for 3 days, followed by flow cytometry to detect hCD19 expression ( right ). (F) At each of the indicated points of the genome-wide CRISPRa screen, the cell population was challenged with Ebola or rabies pseudovirus, and cell infectivity was evaluated by flow cytometry. Upon successive rounds of the screen, the cell population became progressively more susceptible to infection to either Ebola or rabies pseudovirus, respectively. (G) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for Ebola pseudovirus entry. (H) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for rabies pseudovirus entry.

    Journal: bioRxiv

    Article Title: Elucidating genes sufficient for viral entry into cells through sequential genome-wide CRISPR activation screens

    doi: 10.64898/2026.03.06.710083

    Figure Lengend Snippet: (A) Summary of gene deletion vs. gene overexpression approaches. (B) Rationale for the present study. (C) Experimental outline of the present study. (D) HEK293 and Jurkat cells were inoculated with different volumes of Ebola or rabies pseudovirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This revealed that Jurkat cells are largely refractory to Ebola or rabies pseudovirus entry, relative to HEK293 cells. (E) Construction of a clonal Jurkat cell line, known as “Jurkat C6”, stably expressing a degron-tagged CRISPRa construct ( left ). Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence or absence of TMP (1 μM) for 3 days, followed by flow cytometry to detect hCD19 expression ( right ). (F) At each of the indicated points of the genome-wide CRISPRa screen, the cell population was challenged with Ebola or rabies pseudovirus, and cell infectivity was evaluated by flow cytometry. Upon successive rounds of the screen, the cell population became progressively more susceptible to infection to either Ebola or rabies pseudovirus, respectively. (G) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for Ebola pseudovirus entry. (H) sgRNA distribution upon successive rounds of the genome-wide CRISPRa screen for rabies pseudovirus entry.

    Article Snippet: The human genome-wide CRISPRa sgRNA library (hCRISPRa-v2 [Addgene, 1000000091]) comprises 209,080 sgRNAs targeting 18,915 human genes (approximately 10 sgRNAs per gene), in addition to 3,790 non-targeting control sgRNAs .

    Techniques: Over Expression, Marker, Mutagenesis, Flow Cytometry, Infection, Stable Transfection, Expressing, Construct, Transduction, Genome Wide

    A) Plasmids used to pseudotype non-replicating lentiviruses with either Ebola or rabies envelope proteins. EBOV-GP: glycoprotein of Ebola virus, Makona variant. RABV-GP N2C: glycoprotein of rabies virus, N2C variant. B) HEK293 and Jurkat cells were inoculated with different volumes of VSV envelope protein-pseudotyped lentivirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This served as a positive control to confirm that Jurkat cells and HEK293 cells are both susceptible to VSV pseudovirus entry. C) Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence of different TMP concentrations (0-4 μM) for 2-3 days, followed by flow cytometry to detect human CD19 expression.

    Journal: bioRxiv

    Article Title: Elucidating genes sufficient for viral entry into cells through sequential genome-wide CRISPR activation screens

    doi: 10.64898/2026.03.06.710083

    Figure Lengend Snippet: A) Plasmids used to pseudotype non-replicating lentiviruses with either Ebola or rabies envelope proteins. EBOV-GP: glycoprotein of Ebola virus, Makona variant. RABV-GP N2C: glycoprotein of rabies virus, N2C variant. B) HEK293 and Jurkat cells were inoculated with different volumes of VSV envelope protein-pseudotyped lentivirus encoding a cell-surface marker (mCD19t; a truncated mutant of mouse CD19), followed by flow cytometry to determine the percentage of infected cells. This served as a positive control to confirm that Jurkat cells and HEK293 cells are both susceptible to VSV pseudovirus entry. C) Jurkat C6 cells were transduced with sgRNA targeting the endogenous human CD19 gene, in the presence of different TMP concentrations (0-4 μM) for 2-3 days, followed by flow cytometry to detect human CD19 expression.

    Article Snippet: The human genome-wide CRISPRa sgRNA library (hCRISPRa-v2 [Addgene, 1000000091]) comprises 209,080 sgRNAs targeting 18,915 human genes (approximately 10 sgRNAs per gene), in addition to 3,790 non-targeting control sgRNAs .

    Techniques: Virus, Variant Assay, Marker, Mutagenesis, Flow Cytometry, Infection, Positive Control, Transduction, Expressing

    A) NGFR was expressed in Jurkat C6 cells using CRISPRa, or alternatively, Jurkat cells using cDNA expression. NGFR -expressing or control cells were then inoculated with rabies pseudovirus encoding mCD19t. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that NGFR expression significantly increased the susceptibility of Jurkat cells to rabies pseudovirus infection. B) L-SIGN or DC-SIGN were expressed in Jurkat or primary human CD4 + T cells using cDNA expression. L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with rabies pseudovirus encoding hEGFRt (a truncated mutant of human EGFR). Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of Jurkat cells and primary T cells to Ebola pseudovirus infection. C) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression, and then L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with GFP -expressing Ebola virus or zsGreen -expressing Sudan virus under BSL4 containment. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of primary T cells to authentic Ebola and Sudan virus infection.

    Journal: bioRxiv

    Article Title: Elucidating genes sufficient for viral entry into cells through sequential genome-wide CRISPR activation screens

    doi: 10.64898/2026.03.06.710083

    Figure Lengend Snippet: A) NGFR was expressed in Jurkat C6 cells using CRISPRa, or alternatively, Jurkat cells using cDNA expression. NGFR -expressing or control cells were then inoculated with rabies pseudovirus encoding mCD19t. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that NGFR expression significantly increased the susceptibility of Jurkat cells to rabies pseudovirus infection. B) L-SIGN or DC-SIGN were expressed in Jurkat or primary human CD4 + T cells using cDNA expression. L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with rabies pseudovirus encoding hEGFRt (a truncated mutant of human EGFR). Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of Jurkat cells and primary T cells to Ebola pseudovirus infection. C) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression, and then L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with GFP -expressing Ebola virus or zsGreen -expressing Sudan virus under BSL4 containment. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of primary T cells to authentic Ebola and Sudan virus infection.

    Article Snippet: The human genome-wide CRISPRa sgRNA library (hCRISPRa-v2 [Addgene, 1000000091]) comprises 209,080 sgRNAs targeting 18,915 human genes (approximately 10 sgRNAs per gene), in addition to 3,790 non-targeting control sgRNAs .

    Techniques: Expressing, Control, Flow Cytometry, Infection, Mutagenesis, Virus

    A) NGFR was expressed in Jurkat C6 cells using CRISPRa, or alternatively, Jurkat cells using cDNA expression. NGFR -expressing or control cells were then inoculated with rabies pseudovirus encoding mCD19t. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that NGFR expression significantly increased the susceptibility of Jurkat cells to rabies pseudovirus infection. As positive controls, flow cytometry was used to confirm successful delivery of the sgRNA construct as part of the CRISPRa workflow (as denoted by BFP expression) and that NGFR was expressed (upon cDNA expression). B) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression. L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with rabies pseudovirus encoding hEGFRt (a truncated mutant of human EGFR). Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of Jurkat cells and primary T cells to Ebola pseudovirus infection. Cells expressing the highest levels of L-SIGN and DC-SIGN were preferentially infected by Ebola pseudovirus. C) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression, and then L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with GFP -expressing Ebola virus or zsGreen -expressing Sudan virus under BSL4 containment. On days 0, 1, and 2 post-infection, flow cytometry was performed to determine the percentage of infected cells and qPCR was performed on cell culture supernatants to quantify viral genome replication. This revealed that L-SIGN or DC-SIGN expression enabled authentic Ebola and Sudan virus entry into primary human T cells, but viral genome replication was impaired, perhaps reflective of cell-intrinsic restriction factors.

    Journal: bioRxiv

    Article Title: Elucidating genes sufficient for viral entry into cells through sequential genome-wide CRISPR activation screens

    doi: 10.64898/2026.03.06.710083

    Figure Lengend Snippet: A) NGFR was expressed in Jurkat C6 cells using CRISPRa, or alternatively, Jurkat cells using cDNA expression. NGFR -expressing or control cells were then inoculated with rabies pseudovirus encoding mCD19t. Flow cytometry was then performed to determine the percentage of infected cells. This revealed that NGFR expression significantly increased the susceptibility of Jurkat cells to rabies pseudovirus infection. As positive controls, flow cytometry was used to confirm successful delivery of the sgRNA construct as part of the CRISPRa workflow (as denoted by BFP expression) and that NGFR was expressed (upon cDNA expression). B) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression. L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with rabies pseudovirus encoding hEGFRt (a truncated mutant of human EGFR). Flow cytometry was then performed to determine the percentage of infected cells. This revealed that L-SIGN or DC-SIGN expression significantly increased the susceptibility of Jurkat cells and primary T cells to Ebola pseudovirus infection. Cells expressing the highest levels of L-SIGN and DC-SIGN were preferentially infected by Ebola pseudovirus. C) L-SIGN or DC-SIGN were expressed in primary human CD4 + T cells using cDNA expression, and then L-SIGN -expressing, DC-SIGN -expressing, or control cells were inoculated with GFP -expressing Ebola virus or zsGreen -expressing Sudan virus under BSL4 containment. On days 0, 1, and 2 post-infection, flow cytometry was performed to determine the percentage of infected cells and qPCR was performed on cell culture supernatants to quantify viral genome replication. This revealed that L-SIGN or DC-SIGN expression enabled authentic Ebola and Sudan virus entry into primary human T cells, but viral genome replication was impaired, perhaps reflective of cell-intrinsic restriction factors.

    Article Snippet: The human genome-wide CRISPRa sgRNA library (hCRISPRa-v2 [Addgene, 1000000091]) comprises 209,080 sgRNAs targeting 18,915 human genes (approximately 10 sgRNAs per gene), in addition to 3,790 non-targeting control sgRNAs .

    Techniques: Expressing, Control, Flow Cytometry, Infection, Construct, Mutagenesis, Virus, Cell Culture

    Genome-wide CRISPR-Cas9 screen identifies genetic determinants of GTE-induced cytotoxicity. (A) Schematic overview of the experimental workflow for the genome-wide CRISPR knockout screen in NALM-6 cells treated with green tea extract (GTE), aimed at identifying genes modulating compound sensitivity. (B) Distribution of CRANKS scores for 19,034 genes following GTE treatment. Negative scores (red arrows, CRANKS ≤ −2) indicate sensitizer genes whose knockout enhances compound sensitivity, while positive scores (green arrows, CRANKS ≥2) represent rescuers whose knockout confers resistance. The 2D scatter plot is aligned with a one-dimensional frequency distribution, illustrating the thresholds used to define top hits. (C) Volcano plot showing CRANKS scores plotted against –log 10 p -values. Genes above the horizontal dashed line marks the p -threshold ( p < 0.05), while those beyond the vertical dashed lines exceed CRANKS thresholds of ±2, identifying 30 filtered genes ( p ≤ 0.01) labeled by gene symbol. Red points represent sensitizers; green points represent rescuers. Listed starred gene (∗) indicate top hits. (D) KEGG pathway enrichment analysis of highest CRANKS-filtered candidates (|CRANKS| ≥ 2; p ≤ 0.01; set including all top hits). Bubble color reflects false discovery rate (FDR), ranging from light green (FDR = 9 × 10 −7 ) to dark blue (FDR = 4 × 10 −3 ), and bubble size corresponds to the number of genes in each pathway. Pathways are ranked by significance on the y-axis. Analysis was performed using the STRING database with whole-genome background, requiring a minimum of two genes per pathway and FDR ≤0.05.

    Journal: Redox Biology

    Article Title: CRISPR-based chemogenomic profiling reveals redox vulnerabilities to epigallocatechin-3-gallate and green tea polyphenol extract

    doi: 10.1016/j.redox.2026.104047

    Figure Lengend Snippet: Genome-wide CRISPR-Cas9 screen identifies genetic determinants of GTE-induced cytotoxicity. (A) Schematic overview of the experimental workflow for the genome-wide CRISPR knockout screen in NALM-6 cells treated with green tea extract (GTE), aimed at identifying genes modulating compound sensitivity. (B) Distribution of CRANKS scores for 19,034 genes following GTE treatment. Negative scores (red arrows, CRANKS ≤ −2) indicate sensitizer genes whose knockout enhances compound sensitivity, while positive scores (green arrows, CRANKS ≥2) represent rescuers whose knockout confers resistance. The 2D scatter plot is aligned with a one-dimensional frequency distribution, illustrating the thresholds used to define top hits. (C) Volcano plot showing CRANKS scores plotted against –log 10 p -values. Genes above the horizontal dashed line marks the p -threshold ( p < 0.05), while those beyond the vertical dashed lines exceed CRANKS thresholds of ±2, identifying 30 filtered genes ( p ≤ 0.01) labeled by gene symbol. Red points represent sensitizers; green points represent rescuers. Listed starred gene (∗) indicate top hits. (D) KEGG pathway enrichment analysis of highest CRANKS-filtered candidates (|CRANKS| ≥ 2; p ≤ 0.01; set including all top hits). Bubble color reflects false discovery rate (FDR), ranging from light green (FDR = 9 × 10 −7 ) to dark blue (FDR = 4 × 10 −3 ), and bubble size corresponds to the number of genes in each pathway. Pathways are ranked by significance on the y-axis. Analysis was performed using the STRING database with whole-genome background, requiring a minimum of two genes per pathway and FDR ≤0.05.

    Article Snippet: Briefly, a human NALM-6 (pre-B ALL lymphocytes) clone bearing an integrated inducible Cas9 expression cassette generated by lentiviruses made from pCW-Cas9 (Addgene #50661) was transduced with the genome-wide KO EKO sgRNA library (278,754 different sgRNAs).

    Techniques: Genome Wide, CRISPR, Knock-Out, Labeling

    EGCG-induced pro-oxidant mechanisms: Insights from genome-wide CRISPR screening. (1) EGCG undergoes auto-oxidation generating reactive oxygen species (ROS) such as hydrogen peroxide (H 2 O 2 ) and quinone intermediates. A genome-wide CRISPR-Cas9 screen identified key genes modulating cellular response to EGCG-induced oxidative stress. (2) Knockouts of glutathione biosynthesis genes ( GCLC , GCLM , GSS ) impair H 2 O 2 detoxification, sensitizing cells to ferroptosis. (3) Peroxisomal genes ( PEX1 , PEX6 , PEX12 , PEX14 ) regulate ROS metabolism; their disruption compromises H 2 O 2 clearance via catalase ( CAT ) and peroxiredoxin-1 ( PRDX1 ). (4) The KEAP1-NRF2 axis controls antioxidant gene expression, inducing enzymes (e.g., CAT, PRDX1, GCLs) that mitigate ROS toxicity. KEAP1 knockout enhances NRF2 signaling and confers resistance. (5) Additional modulators include ABCC1 (drug efflux), SLC7A11 (cysteine transporter) and BAK1 (apoptosis). Sensitizer hits (red labels) indicate knockouts that heighten EGCG toxicity, while resistance hits (green labels) protect against cell death. Color intensity reflects CRANKS scores relative to the highest scoring genes. Together, these findings illustrate how EGCG's pro-oxidant activity can overwhelm cancer cell defenses when redox-regulating pathways are genetically compromised.

    Journal: Redox Biology

    Article Title: CRISPR-based chemogenomic profiling reveals redox vulnerabilities to epigallocatechin-3-gallate and green tea polyphenol extract

    doi: 10.1016/j.redox.2026.104047

    Figure Lengend Snippet: EGCG-induced pro-oxidant mechanisms: Insights from genome-wide CRISPR screening. (1) EGCG undergoes auto-oxidation generating reactive oxygen species (ROS) such as hydrogen peroxide (H 2 O 2 ) and quinone intermediates. A genome-wide CRISPR-Cas9 screen identified key genes modulating cellular response to EGCG-induced oxidative stress. (2) Knockouts of glutathione biosynthesis genes ( GCLC , GCLM , GSS ) impair H 2 O 2 detoxification, sensitizing cells to ferroptosis. (3) Peroxisomal genes ( PEX1 , PEX6 , PEX12 , PEX14 ) regulate ROS metabolism; their disruption compromises H 2 O 2 clearance via catalase ( CAT ) and peroxiredoxin-1 ( PRDX1 ). (4) The KEAP1-NRF2 axis controls antioxidant gene expression, inducing enzymes (e.g., CAT, PRDX1, GCLs) that mitigate ROS toxicity. KEAP1 knockout enhances NRF2 signaling and confers resistance. (5) Additional modulators include ABCC1 (drug efflux), SLC7A11 (cysteine transporter) and BAK1 (apoptosis). Sensitizer hits (red labels) indicate knockouts that heighten EGCG toxicity, while resistance hits (green labels) protect against cell death. Color intensity reflects CRANKS scores relative to the highest scoring genes. Together, these findings illustrate how EGCG's pro-oxidant activity can overwhelm cancer cell defenses when redox-regulating pathways are genetically compromised.

    Article Snippet: Briefly, a human NALM-6 (pre-B ALL lymphocytes) clone bearing an integrated inducible Cas9 expression cassette generated by lentiviruses made from pCW-Cas9 (Addgene #50661) was transduced with the genome-wide KO EKO sgRNA library (278,754 different sgRNAs).

    Techniques: Genome Wide, CRISPR, Disruption, Gene Expression, Knock-Out, Activity Assay